The 3'-terminal sequence of mitochondrial 13S ribosomal RNA.
نویسندگان
چکیده
We have examined the 3'-terminal sequence of the "small" structural ribosomal RNA ("13S") of hamster cell mitochondria, using a procedure involving [3H]isoniazide labeling of samples subjected to sequential periodate oxidation and beta-elimination. The terminus was found to be PyUAUUAOH, which is similar, but not identical, to the corresponding terminus of eukaryotic cytoplasmic 18S rRNA.
منابع مشابه
The sequence of a possible 5S RNA-equivalent in hamster mitochondria.
We have sequenced 3SE RNA, an unmodified species from hamster cell mitochondria that may be a 5S rRNA-equivalent. The sequence is [[Formula: see text]. The underlined stretches can form the stems of 2 hairpins whose existence is supported by S1 nuclease analysis. Residues 24 through 34 can also base-pair extensively with a sequence in the 3'-region of the small subunit ("13S") mitochondrial rRN...
متن کاملNature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.
The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. Wh...
متن کاملThe mitochondrial ribosome of Xenopus laevis.
A mitochondrial ribosome with an approximate sedimentation coefficient of 60 S has been isolated from the ovary of the South African clawed toad, Xenopus laevis. This ribosome is active in a submitochondrial protein-synthesizing system. It contains two species of RNA, designated as "21S" and 13S RNA, which have sequences complementary to mitochondrial DNA and share no detectable sequence homolo...
متن کامل3'-Terminal sequence of wheat mitochondrial 18S ribosomal RNA: further evidence of a eubacterial evolutionary origin
We have determined the sequences of the 3'-terminal approximately 100 nucleotides of [5' -32P]pCp-labeled wheat mitochondrial, wheat cytosol, and E. coli small sub-unit rRNAs. Sequence comparison demonstrates that within this region, there is a substantially greater degree of homology between wheat mitochondrial 18S and E. coli 16S rRNAs than between either of these and wheat cytosol 18S rRNA. ...
متن کاملMethylation status of 13S ribosomal RNA from hamster mitochondria: the presence of a novel riboside, N4-methylcytidine.
The ribosomal RNA ("13S" RNA) of the small ribosomal subunit of hamster cell mitochondria has been found to have a distinctive pattern of methylated residues. Each molecule contained, on the average, approximately one residue of m4Cp, m5Cp and m5Up, and two residues of m62Ap. The natural occurrence of m4Cp has not previously been reported; we propose that this nucleotide is homologous to its ri...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Nucleic acids research
دوره 3 5 شماره
صفحات -
تاریخ انتشار 1976